Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BRIP1

Gene ID (NCBI) 83990
Gene Symbol BRIP1
Protein Name BRCA1 interacting protein C-terminal helicase 1
Synonyms BACH1|FANCJ|OF
Databases KEGG hsa:83990 |  NCBI Gene 83990
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15362)


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE048126 W01A120F06 pENTR-TOPO flj0018g03 AK074713 NM_032043  
HGE048128 W01A120F08 pENTR-TOPO flj0018g03 AK074713 NM_032043  
HGE048132 W01A120F12 pENTR-TOPO flj0018g03 AK074713 NM_032043  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348858 RBb72C10 pGCAP1 NM_032043.1  
GGAGGGGGCGGGAGGCGGGAATTCGTCTCGGGTTGTGTGGTTGAGGGGTCTGGTGGGTCG
HKR387602 RBd69A02 pGCAP10 NM_032043.1  
CGGCCGGCCGATTGGTGTGGTTGAGGGGTCTGGTGGGTCGAGGAAAGGTAACGGCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl