Prev. |  KEGG KO K15362 > 

RIKEN DNA Bank Human Resource - BRIP1

Gene ID NCBI Gene 83990 |  KEGG hsa:83990
Gene Symbol BRIP1
Protein Name BRCA1 interacting protein C-terminal helicase 1
Synonyms BACH1|FANCJ|OF
Ortholog resource in our bank

  BRIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE048126 W01A120F06 pENTR-TOPO flj0018g03 AK074713 NM_032043  
HGE048128 W01A120F08 pENTR-TOPO flj0018g03 AK074713 NM_032043  
HGE048132 W01A120F12 pENTR-TOPO flj0018g03 AK074713 NM_032043  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348858 RBb72C10 pGCAP1 NM_032043.1  
GGAGGGGGCGGGAGGCGGGAATTCGTCTCGGGTTGTGTGGTTGAGGGGTCTGGTGGGTCG
HKR387602 RBd69A02 pGCAP10 NM_032043.1  
CGGCCGGCCGATTGGTGTGGTTGAGGGGTCTGGTGGGTCGAGGAAAGGTAACGGCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl