Prev. |  KEGG KO K17258 > 

RIKEN DNA Bank Human Resource - FAM234A

Gene ID NCBI Gene 83986 |  KEGG hsa:83986
Gene Symbol FAM234A
Protein Name family with sequence similarity 234 member A
Synonyms C16orf9|ITFG3|gs19
Ortholog resource in our bank

  FAM234A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007856 IRAK019K16 pCMV-SPORT6 BC010521 NM_032039 Partial
HGX008416 IRAK021A16 pCMV-SPORT6 BC013047 NM_032039 Full
HGY093584 IRAL033P24 pOTB7 BC032112 NM_032039 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064502 ARe61E06 pKA1U5 NM_032039.2  
GGAGAGGCCGCGGCGGCAGGGTCTCACTCTGNCCCCTNAACTGGAATGTAGTGATAATGA
HKR222201 ARiS055I09 pGCAP10 NM_032039.2  
GGGGGCCAGCGGCGCGNGCGGGTGAGAGGCCGCGGCGGCAGGTCCACCTGGGCTTGCGAA
HKR279573 ARiS198P13 pGCAP10 NM_032039.2  
GGGGTGAGAGGCCGCGGCGGCAGGTCCACCTGGGCTTGCGAAGGCACAGATTCCCCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl