Prev. |  KEGG KO K23677 > 

RIKEN DNA Bank Human Resource - SPNS1

Gene ID NCBI Gene 83985 |  KEGG hsa:83985
Gene Symbol SPNS1
Protein Name sphingolipid transporter 1 (putative)
Synonyms HSpin1|LAT|PP2030|SLC62A1|SPIN1|SPINL|nrs
Ortholog resource in our bank

  SPNS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033147 IRAK082O11 pCMV-SPORT6 BC038961 NM_032038 Full
HGX039333 IRAK098F13 pCMV-SPORT6 BC047741 NM_032038 Full/var
HGX056302 IRAK140M14 pCMV-SPORT6 BC065235 NM_032038 Full/var
HGY087378 IRAL018H10 pOTB7 BC006156 NM_032038 Partial
HGY089241 IRAL023B17 pOTB7 BC008325 NM_032038 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007612 W01A019A12 pENTR-TOPO IRAK140M14 BC065235 NM_032038  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320971 RBb02H03 pKA1U5 NM_032038.1  
GCTTTAAGCAACATGGCGGCTGCCGTGGTGCAGCGCCCGGGCTGAGCGACAGCAAGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl