Prev. | 

RIKEN DNA Bank Human Resource - TM2D1

Gene ID NCBI Gene 83941 |  KEGG hsa:83941
Gene Symbol TM2D1
Protein Name TM2 domain containing 1
Synonyms BBP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019248 IRAK048B24 pBluescriptR BC029486 NM_032027 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090401 M01C026A01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090449 M01C026C01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090497 M01C026E01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090545 M01C026G01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090593 M01C026I01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090641 M01C026K01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090689 M01C026M01 pDONR221 MGC02-E01 BC029486 NM_032027  
HGE090737 M01C026O01 pDONR221 MGC02-E01 BC029486 NM_032027  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186507 ARi66E11 pGCAP10 NM_032027.2  
GGGTCTCCAAGATGGCGGCCGCCTGGCCGTCTGGTCCGTCTGCTCCGGAGGCCGTGACGG
HKR321376 RBb03H08 pKA1U5 NM_032027.2  
GAGAAAGTGTCGGTCTCCAAGATGGCGGCCGCCTGGNCGTCTGGTCCGTCTGCTCCGGAG
HKR387727 RBd69F07 pGCAP10 NM_032027.2  
GGAGAAAGTGTCGGTCTCCAAGATGGCGGCCGCCTGGCCGTCTGGTCCGTCTGCTCCGGA
HKR405498 RBdS013M10 pGCAP10 NM_032027.2  
GGAGNNNNTGTCGGTCTCCAAGATGGCGGCCGCCTGGCCGTCTGGTCCGTCTGCTCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl