Prev. |  KEGG KO K15026 > 

RIKEN DNA Bank Human Resource - EIF2A

Gene ID NCBI Gene 83939 |  KEGG hsa:83939
Gene Symbol EIF2A
Protein Name eukaryotic translation initiation factor 2A
Synonyms CDA02|EIF-2A|MST089|MSTP004|MSTP089
Ortholog resource in our bank

  EIF2A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091302 IRAL028E06 pOTB7 BC011885 NM_032025 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068123 ARe70F03 pKA1U5 NM_032025.3  
GCTCTTTCCGGGACAACATGGCGCCGTCCACGCCGCTCTTGACAGTCCGAGGATCAGAAG
HKR078083 ARe95D11 pKA1U5 NM_032025.3  
GCTCTTTCCGGGACAACATGGCGCCGNTCCACGCCGCTCTTGACAGTCCGAGGATCAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl