Prev. | 

RIKEN DNA Bank Human Resource - STARD3NL

Gene ID NCBI Gene 83930 |  KEGG hsa:83930
Gene Symbol STARD3NL
Protein Name STARD3 N-terminal like
Synonyms MENTHO
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082893 IRAL007D21 pOTB7 BC003074 NM_032016 Full
HGY088601 IRAL021I09 pDNR-LIB BC005959 NM_032016 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045603 W01A114A03 pENTR-TOPO IRAL021I09 BC005959 NM_032016  
HGE045605 W01A114A05 pENTR-TOPO IRAL021I09 BC005959 NM_032016  
HGE045607 W01A114A07 pENTR-TOPO IRAL021I09 BC005959 NM_032016  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205272 ARiS013C24 pGCAP10 NM_032016.2  
GTCCGCAGTTCCCGGGCCAGCCTGGGGCGGCCGGCCAGGAACCACCCGTTAAGGGTCTTA
HKR260096 ARiS150D24 pGCAP10 NM_032016.2  
GCCCGCCCCTCAGGCCGGGGCGCGACCGCGGATCCGCAGTTCCCGGGCCAGCCTGGGGCG
HKR386412 RBd66A12 pGCAP10 NM_032016.2  
CGGCCGNNCGATGGCCCCCGCCCCTCAGGCCGGGGCGCGACCGCGGATCCGCAGTTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl