DNA Bank Top |  KEGG KO K07921 > 

RIKEN DNA Bank Human Resource - RAB34

Gene ID NCBI Gene 83871 |  KEGG hsa:83871
Gene Symbol RAB34
Protein Name RAB34, member RAS oncogene family
Synonyms NARR|RAB39|RAH
Featured content Rab Family - human

Link

Ortholog resource in our bank

  RAB34

External database

human RAB34

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20879 pEGFP-C1-hRab34 Expression vector of human Rab34 tagged with EGFP at N-terminus    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067016 IRAK167I24 pBluescriptR BC066904 NM_031934 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2025Apr02.csv
GNP_full_IRAL_2025Apr02.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247448 ARiS118K08 pGCAP10 NM_031934.3  
TGGCCCCTCCCTGCTGGTTCCTGGCATCGCCAGATGCTGCGCAGCAGTCTCCGATTCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_20250404.csv
NRCDhumcloneList_RB_20250404.csv

2025.05.08

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl