DNA Bank Top |  KEGG KO K06785 > 

RIKEN DNA Bank Human Resource - JAM3

Gene ID NCBI Gene 83700 |  KEGG hsa:83700
Gene Symbol JAM3
Protein Name junctional adhesion molecule 3
Synonyms JAM-2|JAM-3|JAM-C|JAMC

Link

Ortholog resource in our bank

  JAM3


External database

human JAM3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07637 pTarget-hJAM3 Expression vector of human JAM3    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047746 IRAK119G02 pCMV-SPORT6 BC063031
HGY091627 IRAL029B03 pOTB7 BC012147 NM_032801 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE122416 M01C106A16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122464 M01C106C16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122512 M01C106E16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122560 M01C106G16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122608 M01C106I16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122656 M01C106K16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122704 M01C106M16 pDONR221 06_13-F08 AK074769 NM_032801  
HGE122752 M01C106O16 pDONR221 06_13-F08 AK074769 NM_032801  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209377 ARiS023H09 pGCAP10 NM_032801.3  
GAGCAACCCTCGACATGGCGCTGAGGCGGCCACCGCGACTCCGGCTCTGCGCTCGGCTGC
HKR322029 RBb05B05 pKA1U5 NM_032801.3  
GCTCAGCAACCCTCGACATGGCGCTGAGGCGGCCACCGCGACTCCGGCTCTGCGCTCGGC
HKR409021 RBdS022J05 pGCAP10 NM_032801.3  
GGCCGCNCTGCCGCTGGCCCCTCNNNNACCCTCNACATGGTCCTGANGCNNGCNCCGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl