Prev. |  KEGG KO K20394 > 

RIKEN DNA Bank Human Resource - SESN2

Gene ID NCBI Gene 83667 |  KEGG hsa:83667
Gene Symbol SESN2
Protein Name sestrin 2
Synonyms HI95|SES2|SEST2
Ortholog resource in our bank

  SESN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07413 pGL4-phSESN2 Promoter collection, Human SESN2 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027348 IRAK068G04 pCMV-SPORT6 BC033719 NM_031459 Full
HGY084347 IRAL010O11 pOTB7 BC013304 NM_031459 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007218 W01A018A18 pENTR-TOPO IRAL010O11 BC013304 NM_031459  
HGE007220 W01A018A20 pENTR-TOPO IRAL010O11 BC013304 NM_031459  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336808 RBb42A08 pGCAP1 NM_031459.3  
GGTTCCGCGGCGGGGATGCTGAGGAGCGCTGGGTCCGGGAGCAGCCCTGGCCCCTGCGGA
HKR402821 RBdS007A21 pGCAP10 NM_031459.3  
GACCGCAGCGGGCTGAACTGCTGGTGTCAGAGCCCGGCGAGCGCTGGCAGTTCCGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.02

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl