Prev. | 

RIKEN DNA Bank Human Resource - FAM167A

Gene ID NCBI Gene 83648 |  KEGG hsa:83648
Gene Symbol FAM167A
Protein Name family with sequence similarity 167 member A
Synonyms C8orf13|D8S265|DIORA-1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025402 IRAK063I10 pBluescriptR BC029587 NM_053279 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070132 ARe75F12 pKA1U5 NM_053279.2  
GGCCAGGCAACCGCCCTGACGCAACGCAGGGGGCAAANAAAAAAGTCCTTTCCGAAAGGA
HKR378053 RBd45C05 pGCAP10 NM_053279.2  
TGGCTCCTGCCGTTTGGGGGTGGGTGAGGCCCTGGGCGTGGGGTCCCCCTGCGCCCTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl