Prev. | 

RIKEN DNA Bank Human Resource - FAM107B

Gene ID NCBI Gene 83641 |  KEGG hsa:83641
Gene Symbol FAM107B
Protein Name family with sequence similarity 107 member B
Synonyms C10orf45|HITS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069892 IRAK174M04 pCMV-SPORT6 BC072452 NM_031453 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE119616 M01C099A16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119664 M01C099C16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119712 M01C099E16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119760 M01C099G16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119808 M01C099I16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119856 M01C099K16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119904 M01C099M16 pDONR221 IMS13-B08 AK127413 NM_031453  
HGE119952 M01C099O16 pDONR221 IMS13-B08 AK127413 NM_031453  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168005 ARi20A05 pGCAP10 NM_031453.2  
GGAGAGCCGCCCTGCGCCGGACTGGCTTGCGGGCCGGGCCGCCGCCCCCGGAGCCGCCCT
HKR373299 RBd33E03 pGCAP10 NM_031453.2  
GGCCTTTGTGCGCGCGCCGAGACAGCCCACCTGAGGATATTGACCATAAGGACTCATATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl