Prev. |  KEGG KO K18708 > 

RIKEN DNA Bank Human Resource - RAMAC

Gene ID NCBI Gene 83640 |  KEGG hsa:83640
Gene Symbol RAMAC
Protein Name RNA guanine-7 methyltransferase activating subunit
Synonyms C15orf18|FAM103A1|HsT19360|RAM|RAMMET
Ortholog resources KEGG ortholog (KEGG orthology K18708) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010544 IRAK026F24 pCMV-SPORT6 BC027181 NM_031452 Full
HGY081216 IRAL003A16 pOTB7 BC003627 NM_031452

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062032 ARe55B08 pKA1U5 NM_031452.2  
GAGAGGAAGGCGCTCGTGTTACATTGGAGAACTGCCAGTGGTCTGGAGTTCCACGGCTGT
HKR361652 RBd04C04 pGCAP10 NM_031452.2  
GGATTTTAGAGGAAGGCGCTCGGTTACATTGGAGAACTGGAGTGGTCTGGAGTTCCACGG
HKR405262 RBdS013C14 pGCAP10 NM_031452.2  
GGTTGTCGGATTTTANAGGAAGGCGCTCGGTTACATTGGAGAACTGGAGTGGTCTGGAGT
HKR430366 RBdS075P06 pGCAP10 NM_031452.2  
GAGGTGGTTGTCGGATTTTAGAGGAAGGCGCTCGGTTACATTGGAGAACTGGAGTGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl