Prev. | 

RIKEN DNA Bank Human Resource - ZMIZ2

Gene ID NCBI Gene 83637 |  KEGG hsa:83637
Gene Symbol ZMIZ2
Protein Name zinc finger MIZ-type containing 2
Synonyms NET27|TRAFIP20|ZIMP7|hZIMP7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011109 IRAK027M21 pCMV-SPORT6 BC016968 NM_174929 Partial/var
HGY089775 IRAL024H07 pOTB7 BC008049 NM_174929 Partial/var
HGY096130 IRAL040F10 pOTB7 BC021924 NM_031449 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040812 W01A102A12 pENTR-TOPO flj0078i02 AK128359 NM_174929  
HGE040822 W01A102A22 pENTR-TOPO flj0078i02 AK128359 NM_174929  
HGE040852 W01A102C04 pENTR-TOPO flj0078i02 AK128359 NM_174929  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072883 ARe82D11 pKA1U5 NM_031449.3  
GCCCGCTCCCGGCGGACTGCGAGCAGGAAGAGCGCAGTGGCTCTGCCGACGCCGCGTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl