Prev. | 

RIKEN DNA Bank Human Resource - CCM2

Gene ID NCBI Gene 83605 |  KEGG hsa:83605
Gene Symbol CCM2
Protein Name CCM2 scaffold protein
Synonyms C7orf22|OSM|PP10187
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053632 IRAK134B08 pCMV-SPORT6 BC063663 NM_031443 Partial
HGY081042 IRAL002K02 pOTB7 BC016832 NM_031443 Full
HGY084643 IRAL011K03 pOTB7 BC004903 NM_031443 Full
HGY090517 IRAL026E21 pOTB7 BC008859 NM_031443 Full
HGY096916 IRAL042E20 pOTB7 BC025958 NM_031443 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR017231 ARa43B07 pKA1U5 NM_031443.3  
AGTCGGCCGCCGTAAAGATGGCGGCAAATTGAAAAAGTTGGAGCTGCTCCCGCGCGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl