Prev. |  KEGG KO K00876 > 

RIKEN DNA Bank Human Resource - UCK1

Gene ID NCBI Gene 83549 |  KEGG hsa:83549
Gene Symbol UCK1
Protein Name uridine-cytidine kinase 1
Synonyms URK1
Ortholog resource in our bank

  UCK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008125 IRAK020F05 pCMV-SPORT6 BC015547 NM_031432 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038306 W01A095M18 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038310 W01A095M22 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038338 W01A095O02 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038342 W01A095O06 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038346 W01A095O10 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038354 W01A095O18 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE038360 W01A095O24 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE047228 W01A118B04 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE047230 W01A118B06 pENTR-TOPO IRAK020F05 BC015547 NM_031432  
HGE047236 W01A118B12 pENTR-TOPO IRAK020F05 BC015547 NM_031432  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347650 RBb69C02 pGCAP1 NM_031432.1  
GGCGGGAGCGGAGGCCGAGATGGCTTCGGCGGGAGGCGAAGACTGCGAGAGCCCCGCGCC
HKR380497 RBd51E01 pGCAP10 NM_031432.1  
GAGTCGCCTCCGACCTCGGCGCTGGGCGGGCGCGCCGGGCCTGGGGAAGGGGCGGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl