Prev. |  KEGG KO K06072 > 

RIKEN DNA Bank Human Resource - DOHH

Gene ID NCBI Gene 83475 |  KEGG hsa:83475
Gene Symbol DOHH
Protein Name deoxyhypusine hydroxylase
Synonyms HLRC1|hDOHH
Ortholog resource in our bank

  DOHH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084926 IRAL012F06 pOTB7 BC002817 NM_031304 Full
HGY090097 IRAL025E01 pOTB7 BC009863 NM_031304 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098039 M01C045B15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098087 M01C045D15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098135 M01C045F15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098183 M01C045H15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098231 M01C045J15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098279 M01C045L15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098327 M01C045N15 pDONR221 MGC12-C08 BC002817 NM_031304  
HGE098375 M01C045P15 pDONR221 MGC12-C08 BC002817 NM_031304  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184571 ARi61H03 pGCAP10 NM_031304.3  
CGGCCGGCCGATGAGACCGCACTGCGGGCGTCGCGGCAGGTGAAGCGGTGGTGGCAGAGG
HKR279298 ARiS198E02 pGCAP10 NM_031304.3  
GAGGAGAAAATGGCGGCCCCCAGACCGCACTGCGGGCGTCGCGGCAGGTGAAGCGGTGGT
HKR406053 RBdS015C05 pGCAP10 NM_031304.3  
GGTCCGGCACGGTCACGTGGGCGAGAAAATGGCGGCCCCCAGACCGCACTGCGGGCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl