Prev. | 

RIKEN DNA Bank Human Resource - EMC6

Gene ID NCBI Gene 83460 |  KEGG hsa:83460
Gene Symbol EMC6
Protein Name ER membrane protein complex subunit 6
Synonyms RAB5IFL|TMEM93
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081754 IRAL004G10 pOTB7 BC001409 NM_031298 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113622 M01C084A22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113670 M01C084C22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113718 M01C084E22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113766 M01C084G22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113814 M01C084I22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113862 M01C084K22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113910 M01C084M22 pDONR221 IMS05-F11 BC001409 NM_031298  
HGE113958 M01C084O22 pDONR221 IMS05-F11 BC001409 NM_031298  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040851 ARe02C03 pKA1U5 NM_031298.2  
GAGTCTTCCGAGCAAGATGGCGCCGCGGGCATTTCTTCCACTGCCCGTCTGAGGGAACGC
HKR416323 RBdS040N11 pGCAP10 NM_031298.2  
GAGTCTTCCGAGCAAGATGGCGCCGCGGGCATTTCTTCCACTGCCCGTCTGAGGGAACGC
HKR461681 RBdS154D09 pGCAP10 NM_031298.2  
GAGTCTTCCGAGCAAGATGGCGCCGCGGGCATTTCTTCCACTGCCCGTCTGAGGGAACGC
HKR475070 RBdS187L06 pGCAP10 NM_031298.2  
GAGTCTTCCGAGCAAGATGGCGCCGCGGGCATTTCTTCCACTGCCCGTCTGAGGGAACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl