Prev. |  KEGG KO K13703 > 

RIKEN DNA Bank Human Resource - ABHD11

Gene ID NCBI Gene 83451 |  KEGG hsa:83451
Gene Symbol ABHD11
Protein Name abhydrolase domain containing 11
Synonyms PP1226|WBSCR21
Ortholog resource in our bank

  ABHD11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067081 IRAK167L17 pBluescriptR BC067750 NM_148912 Full
HGY091029 IRAL027J13 pOTB7 BC011712 NM_148916 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238503 ARiS096E07 pGCAP10 NM_148912.2  
GGTGAGATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGG
HKR330973 RBb27H05 pGCAP1 NM_148912.2  
GGAGATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl