Prev. |  KEGG KO K11666 > 

RIKEN DNA Bank Human Resource - INO80B

Gene ID NCBI Gene 83444 |  KEGG hsa:83444
Gene Symbol INO80B
Protein Name INO80 complex subunit B
Synonyms HMGA1L4|HMGIYL4|IES2|PAP-1BP|PAPA-1|PAPA1|ZNHIT4|hIes2
Ortholog resource in our bank

  INO80B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044369 IRAK110P09 pCMV-SPORT6 BC050666 NM_031288 Full
HGX055938 IRAK139O02 pCMV-SPORT6 BC064425 NM_031288 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042031 ARe05B07 pKA1U5 NM_031288.2  
GCCCCTTTCCTCGCAGGACCTCATGAGTAAGCTGTGGCGGCGCTGGGAGCACCTCTGGGG
HKR058925 ARe47F05 pKA1U5 NM_031288.2  
GCCTTTCCTCGCAGGACCTCATGAGTAAGCTGTGGCNGCGTGGGAGCACCTCTGGGGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl