Prev. |  KEGG KO K12832 > 

RIKEN DNA Bank Human Resource - SF3B5

Gene ID NCBI Gene 83443 |  KEGG hsa:83443
Gene Symbol SF3B5
Protein Name splicing factor 3b subunit 5
Synonyms SF3b10|Ysf3
Ortholog resource in our bank

  SF3B5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082707 IRAL006M19 pOTB7 BC000198 NM_031287 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036405 W01A091A05 pENTR-TOPO flj0057g02 AK074417 NM_031287  
HGE036409 W01A091A09 pENTR-TOPO flj0057g02 AK074417 NM_031287  
HGE036411 W01A091A11 pENTR-TOPO flj0057g02 AK074417 NM_031287  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056002 ARe40A02 pKA1U5 NM_031287.2  
GGTAAAACGCTAGAGCGGCGAGTTGTTACCTGCGTCCTCTGACCTGAGAGCGAAGGGGAA
HKR060009 ARe50A09 pKA1U5 NM_031287.2  
GACTCTCCTGTAAAACGCTAGAGCGGCGAGTTGTTACCTGCGNTCCTCTGACCTGAGAGC
HKR260006 ARiS150A06 pGCAP10 NM_031287.2  
GACTCTGNGGTNAAACNCTNNNNCGGCNAGTTGTTACCTGCGNCCTCTGACCTGAGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl