Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF93

Gene ID NCBI Gene 81931 |  KEGG hsa:81931
Gene Symbol ZNF93
Protein Name zinc finger protein 93
Synonyms HPF34|HTF34|TF34|ZNF505
Ortholog resource in our bank

  ZNF93

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032841 IRAK082B17 pCMV-SPORT6 BC039001 NM_031218 Partial/var
HGY102903 IRAL057E07 pDNR-LIB BC070372 NM_031218

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE049564 W01A123P04 pENTR-TOPO flj0040e13 AK096342 NM_031218  
HGE049568 W01A123P08 pENTR-TOPO flj0040e13 AK096342 NM_031218  
HGE049932 W01A124N20 pENTR-TOPO flj0040e13 AK096342 NM_031218  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384899 RBd62E03 pGCAP10 NM_031218.2  
GGTCTCTCGGTGCAGCCGGAGCTCCAGGTCTCCTCTTCACTACTCTGTGTCCTGTGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl