Prev. |  KEGG KO K14299 > 

RIKEN DNA Bank Human Resource - SEH1L

Gene ID NCBI Gene 81929 |  KEGG hsa:81929
Gene Symbol SEH1L
Protein Name SEH1 like nucleoporin
Synonyms SEC13L|SEH1A|SEH1B|Seh1
Ortholog resource in our bank

  SEH1L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008661 IRAK021K21 pCMV-SPORT6 BC012430 NM_031216 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092417 M01C031A17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092465 M01C031C17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092513 M01C031E17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092561 M01C031G17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092609 M01C031I17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092657 M01C031K17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092705 M01C031M17 pDONR221 MGC05-A09 BC012430 NM_031216  
HGE092753 M01C031O17 pDONR221 MGC05-A09 BC012430 NM_031216  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053329 ARe33F09 pKA1U5 NM_031216.3  
GAAGCCGTGCGCTCCCGGGCTGCGAGGTCTGGCTAGGCTACGGGCCACGCGCCGCCGCCG
HKR076453 ARe91C05 pKA1U5 NM_031216.3  
GGGCTAGGCTACGGGCCACGCGCCGCCGCCGCTGCCGCCGCCACTGNTCCTCTTCGGAGG
HKR082552 ARf06G08 pKA1U5 NM_031216.3  
GAGGCTACGGGCCACGCGCCGCCGCCGCTGCCGCCGCCACTGNTCCTCTTCGGAGGCGCG
HKR390130 RBd75F10 pGCAP10 NM_031216.3  
GCGGGCTGCGAGGTCTGGCTAGGCTACGGGCCACGCGCCGCCGCCGCTGCCGCCGCCACT
HKR395658 RBd89C10 pGCAP10 NM_031216.3  
GAGGGGCGGTGCGGGGGCGTGGGCAGCACAAGCCGTGCGCTCCCGGGCTGCGAGGTCTGG
HKR461684 RBdS154D12 pGCAP10 NM_031216.3  
GAGGGGCGGTGCGGGGGCGTGGGCAGCACAAGCCGTGCGCTCCCGGGCTGCGAGGTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl