Prev. | 

RIKEN DNA Bank Human Resource - ABHD17A

Gene ID NCBI Gene 81926 |  KEGG hsa:81926
Gene Symbol ABHD17A
Protein Name abhydrolase domain containing 17A
Synonyms C19orf27|FAM108A1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001235 IRAK003B11 pCMV-SPORT6 BC000158 NM_031213 Full/var
HGX008292 IRAK020M04 pCMV-SPORT6 BC020512 NM_031213
HGX027512 IRAK068M24 pCMV-SPORT6 BC033749 NM_031213 Full/var
HGX066696 IRAK166M08 pCMV-SPORT6 BC071644 NM_031213 Full/var
HGY090217 IRAL025J01 pOTB7 BC009256 NM_031213 Full/var
HGY090476 IRAL026D04 pOTB7 BC011667 NM_031213 Full/var
HGY096770 IRAL041P10 pDNR-LIB BC035961 NM_031213 Full/var
HGY103574 IRAL058P14 pOTB7 BC071876 NM_031213 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084405 M01C011A05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084453 M01C011C05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084501 M01C011E05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084549 M01C011G05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084597 M01C011I05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084645 M01C011K05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084693 M01C011M05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  
HGE084741 M01C011O05 pDONR221 FLJ03-A03 AK074548 ENST00000292577  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052907 ARe32E11 pKA1U5 NM_031213.2  
GGAGGCTCACTTCCGTCCGTGGGGGGAGCTGCGGCGGTGGCGGTGCAGGAGGCCGGGCAG
HKR168035 ARi20B11 pGCAP10 NM_031213.2  
GGAGGCTCACTTCCGTCCGTGGGGGGAGCTGCGGCGGTGGCGGTGCAGGAGGCCGGGCAG
HKR367748 RBd19G04 pGCAP10 NM_031213.2  
GACTTCCGGGGCGGTGGTGAGAACGAGGCTCACTTCCGTCCGTGGGGGGAGCTGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl