Prev. |  KEGG KO K01816 > 

RIKEN DNA Bank Human Resource - HYI

Gene ID NCBI Gene 81888 |  KEGG hsa:81888
Gene Symbol HYI
Protein Name hydroxypyruvate isomerase (putative)
Synonyms HT036
Ortholog resource in our bank

  HYI

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087486 IRAL018L22 pOTB7 BC006140 NM_031207 Full/var
HGY092281 IRAL030L17 pOTB7 BC019041 NM_031207 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126411 M01C116A11 pDONR221 2_5-A06 BC006140 NM_031207  
HGE098833 M01C047B09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE098881 M01C047D09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE098929 M01C047F09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE098977 M01C047H09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE099025 M01C047J09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE099073 M01C047L09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE099121 M01C047N09 pDONR221 MGC13-C05 BC006140 NM_031207  
HGE099169 M01C047P09 pDONR221 MGC13-C05 BC006140 NM_031207  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188474 ARi71D02 pGCAP10 NM_031207.2  
GGTACTGATCAACACGCCCCCGGGAGACCAAGAGAAGGGGGAAATGGGGCTGGGGGCCGT
HKR375607 RBd39A07 pGCAP10 NM_031207.2  
AGGCCCGCCGCCCGCCGCCCGCCGCCTTTGGATCCCGCGGACTCCGCCCGGCCCGGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl