Prev. |  KEGG KO K07875 > 

RIKEN DNA Bank Human Resource - RAB1B

Gene ID NCBI Gene 81876 |  KEGG hsa:81876
Gene Symbol RAB1B
Protein Name RAB1B, member RAS oncogene family
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07875) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069753 IRAK174G09 pCMV-SPORT6 BC071169 NM_030981 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043308 ARe08E12 pKA1U5 NM_030981.2  
GAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGAACCCCGAATATGAC
HKR069609 ARe74A09 pKA1U5 NM_030981.2  
GGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGAACCCCGAATATGACTAC
HKR165653 ARi14C05 pGCAP10 NM_030981.2  
TGGATCTTGGAACGGGAGGCGGAGCAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCC
HKR174522 ARi36F02 pGCAP10 NM_030981.2  
GAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGAACCCCGAATATGAC
HKR178876 ARi47D04 pGCAP10 NM_030981.2  
GGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGAACCCCGAATATGACTACCTGTTTA
HKR218191 ARiS045H23 pGCAP10 NM_030981.2  
GAACGGGAGGCGGAGCAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATG
HKR234077 ARiS085D05 pGCAP10 NM_030981.2  
GACCATCTTGGAACGGGAGGCGGAGCAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGC
HKR260068 ARiS150C20 pGCAP10 NM_030981.2  
GAGGCGGAGCAGAGTCGACTGGGAGCGACCGAGCGGGCCGCCGCCGCCGCCATGAACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl