Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARPC5L

Gene ID (NCBI) 81873
Gene Symbol ARPC5L
Protein Name actin related protein 2/3 complex, subunit 5-like
Synonyms ARC16-2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001749 IRAK004G05 pCMV-SPORT6 BC000798 NM_030978
HGY082115 IRAL005E19 pOTB7 BC002418 NM_030978 Full
HGY083176 IRAL007P16 pOTB7 BC000018 NM_030978 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049302 ARe23E06 pKA1U5 NM_030978.1  
GAGCCGCTTCCCGCCCCCGAGCAGGAGCCGGTGCGAGCGGAGCAGAGCCGAGGTCGGGCC
HKR203361 ARiS008G17 pGCAP10 NM_030978.1  
GGGAGGCGGTGGANGANGTGCTGGGAGCAGCCGGGCAGCCGCTTCCCGCCCCCGAGCAGG
HKR218104 ARiS045E08 pGCAP10 NM_030978.1  
GGGACCCNGTGCNAGCGGAGCACAGCCGAGGTCGGGCCGCGAGCGGAGCCGGCTGAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl