Prev. |  KEGG KO K05754 > 

RIKEN DNA Bank Human Resource - ARPC5L

Gene ID NCBI Gene 81873 |  KEGG hsa:81873
Gene Symbol ARPC5L
Protein Name actin related protein 2/3 complex subunit 5 like
Synonyms ARC16-2
Ortholog resources KEGG ortholog (KEGG orthology K05754) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001749 IRAK004G05 pCMV-SPORT6 BC000798 NM_030978
HGY082115 IRAL005E19 pOTB7 BC002418 NM_030978 Full
HGY083176 IRAL007P16 pOTB7 BC000018 NM_030978 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049302 ARe23E06 pKA1U5 NM_030978.1  
GAGCCGCTTCCCGCCCCCGAGCAGGAGCCGGTGCGAGCGGAGCAGAGCCGAGGTCGGGCC
HKR203361 ARiS008G17 pGCAP10 NM_030978.1  
GGGAGGCGGTGGANGANGTGCTGGGAGCAGCCGGGCAGCCGCTTCCCGCCCCCGAGCAGG
HKR218104 ARiS045E08 pGCAP10 NM_030978.1  
GGGACCCNGTGCNAGCGGAGCACAGCCGAGGTCGGGCCGCGAGCGGAGCCGGCTGAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl