Prev. |  KEGG KO K20894 > 

RIKEN DNA Bank Human Resource - SHARPIN

Gene ID NCBI Gene 81858 |  KEGG hsa:81858
Gene Symbol SHARPIN
Protein Name SHANK associated RH domain interactor
Synonyms SIPL1
Ortholog resource in our bank

  SHARPIN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085101 IRAL012M13 pOTB7 BC002688 NM_030974 Partial/var
HGY090485 IRAL026D13 pOTB7 BC017230 NM_030974 Partial/var
HGY095029 IRAL037J13 pDNR-LIB BC034028 NM_030974 Full/var
HGY097080 IRAL042L16 pOTB7 BC025244 NM_030974 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050908 ARe27E12 pKA1U5 NM_030974.3  
GGACGTGTGGGCGTGGCGGGGGCTGGGGTCTGCGGGCGAAGGTGGTAGCCCATTGGAGGT
HKR068548 ARe71G04 pKA1U5 NM_030974.3  
GGTGGGACCCGGCCGGACCGGAGATGGCGCCGCCATCGGGCGGGGCGGCGGCGGCGGCCT
HKR176504 ARi41E08 pGCAP10 NM_030974.3  
GGGGGTGGGACCCGGCCGGACCGGAGATGGCGCCGCCAGCGGGCGGGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl