Prev. |  KEGG KO K15168 > 

RIKEN DNA Bank Human Resource - MED25

Gene ID NCBI Gene 81857 |  KEGG hsa:81857
Gene Symbol MED25
Protein Name mediator complex subunit 25
Synonyms ACID1|ARC92|BVSYS|CMT2B2|P78|PTOV2|TCBAP0758
Ortholog resource in our bank

  MED25

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008909 IRAK022E13 pCMV-SPORT6 BC024312 NM_030973 Partial/var
HGX056182 IRAK140H14 pCMV-SPORT6 BC065297 NM_030973 Full
HGY087560 IRAL018O24 pOTB7 BC021543 NM_030973 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161299 ARi03E03 pGCAP10 NM_030973.2  
GATTCCGCGGCGTCGGCTGCGGCTGCAGTGGTGGTGGCGGGTACCGCACGGGGTATGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl