Prev. |  KEGG KO K23500 > 

RIKEN DNA Bank Human Resource - SFXN3

Gene ID NCBI Gene 81855 |  KEGG hsa:81855
Gene Symbol SFXN3
Protein Name sideroflexin 3
Synonyms BA108L7.2|SFX3|SLC56A3
Ortholog resource in our bank

  SFXN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082653 IRAL006K13 pOTB7 BC000124 NM_030971 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279477 ARiS198L13 pGCAP10 NM_030971.3  
GATTCCGGCACCTCCCTTAGGCGCCAGGGACAGCCGAGCGTTACCTGGTCCCGGGCAGCG
HKR360924 RBd02F04 pGCAP10 NM_030971.3  
GAGAGGACCGCCCCTCCACACCGCCCACCTGCGCCCGGGGCTTTCTCTCTGGGCACCTAG
HKR366905 RBd17E09 pGCAP10 NM_030971.3  
GGGCCTCGACGGCGGAGGCAGAGACGAGCTGAGCTCTGANAGCTTCTGAGAGCGATGGAA
HKR405894 RBdS014M06 pGCAP10 NM_030971.3  
TGAGAGAGGAAGGCGGTTCTGACAGCTTCNNAGAGCGATGGAAAGCAAAATGGGTGAATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl