RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ADAMTS12

Gene ID	NCBI Gene 81792 \| KEGG hsa:81792
Gene Symbol	ADAMTS12
Protein Name	ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms	PRO4389

Link

Ortholog resource in our bank

ADAMTS12

External database

human ADAMTS12

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB07650	pcDNA3.1(+)-h ADAM TS12

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY099508	IRAL048M20	pDNR-LIB	BC058841	NM_030955	Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR260360	ARiS150O24	pGCAP10	NM_030955.2
HKR260360	TGGGCAGTCGCTGCCTTCNCGCGCCTGACCATGCACCCCTGCATCTTCCTGCTGGGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl