Prev. |  KEGG KO K21852 > 

RIKEN DNA Bank Human Resource - DOCK8

Gene ID NCBI Gene 81704 |  KEGG hsa:81704
Gene Symbol DOCK8
Protein Name dedicator of cytokinesis 8
Synonyms HEL-205|MRD2|ZIR8
Ortholog resource in our bank

  DOCK8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030708 IRAK076M20 pBluescriptR BC043265 NM_203447 Partial/var
HGY095918 IRAL039N06 pOTB7 BC019102 NM_203447 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180474 ARi51D02 pGCAP10 NM_203447.1  
GAGAGCGCGCCGTCTGCCCCAGTATCGGGAGGCCAGTTCCGCGCTGGGCCCACGCCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl