Prev. | 

RIKEN DNA Bank Human Resource - CCNL2

Gene ID NCBI Gene 81669 |  KEGG hsa:81669
Gene Symbol CCNL2
Protein Name cyclin L2
Synonyms ANIA-6B|CCNM|CCNS|HCLA-ISO|HLA-ISO|PCEE|SB138
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04841 SEREX clone NGO-Pr-141 5' (ID 2506); NGO-Pr-141 3' (ID 2508); NGO-Pr-190 5' (ID 2507) #1 SEREX clone NGO-Pr-141 5' (ID 2506); NGO-Pr-141 3' (ID 2508); NGO-Pr-190 5' (ID 2507) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066463 IRAK166C15 pCMV-SPORT6 BC071622 NM_030937 Partial/var
HGY093079 IRAL032L15 pDNR-LIB BC016333 NM_001039577 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063605 ARe59A05 pKA1U5 NM_030937.4  
GGGGGAGTCGGCGGCACAAAATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGGTCGG
HKR064901 ARe62E05 pKA1U5 NM_030937.4  
GGGGGAGTCGGCGGCACAAAATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGGTCGG
HKR346434 RBb66B10 pGCAP1 NM_030937.4  
GGGCACAAAATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGGTCGGCAGCTCCCGCG
HKR368926 RBd22F06 pGCAP10 NM_030937.4  
GNATTGTCATCCCNNNCCNCACCAAGGTCGCGGCNTGANACTTCTTGGNGCCTCCGCCCG
HKR378955 RBd47G11 pGCAP10 NM_030937.4  
GGGGGAGTCGGCGGCACAAAATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGGTCGG
HKR452927 RBdS132F07 pGCAP10 NM_030937.4  
TGGAAGGGGAGTCGGCGGCACAAAATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl