DNA Bank Top |  KEGG KO K10435 > 

RIKEN DNA Bank Human Resource - MAP1LC3B

Gene ID NCBI Gene 81631 |  KEGG hsa:81631
Gene Symbol MAP1LC3B
Protein Name microtubule associated protein 1 light chain 3 beta
Synonyms ATG8F|LC3B|MAP1A/1BLC3|MAP1LC3B-a
Featured content Autophagy (human)
Featured content Mitophagy - human
Featured content Ferroptosis - human

Link

Ortholog resource in our bank

  MAP1LC3B

External database

human MAP1LC3B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19197 pcDNA3.1 3xFLAG::LC3B G120A Expression vectors of human ATG8 homolog LC3B lipidation-defective mutant (G120A) tagged with 3xFLAG at N-terminus.    
RDB19196 pcDNA3.1 3xFLAG::LC3B Expression vectors of human ATG8 homolog LC3B tagged with 3xFLAG at N-terminus.    
RDB13435 pEGFP-C1-hLC3B Indicator of autophagy. Expression clone of human LC3B in mammalian cells    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029975 IRAK074P15 pBluescriptR BC041874 NM_022818 Full
HGY067161 IRAK167P01 pBluescriptR BC067797 NM_022818 Full/var
HGY089619 IRAL024A19 pOTB7 BC018634 NM_022818 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059379 ARe48H11 pKA1U5 NM_022818.3  
GAGAGTCGGATTCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGGACCCTCGCGT
HKR179233 ARi48B09 pGCAP10 NM_022818.3  
GGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGGACCCTCGCGTCGTCGCCGCCGC
HKR365683 RBd14D11 pGCAP10 NM_022818.3  
GGGATTCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGGACCCTCGCGTCGTCGC
HKR370550 RBd26G06 pGCAP10 NM_022818.3  
GAGAGAGTCGGATTCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGGACCCTCGC
HKR372483 RBd31D11 pGCAP10 NM_022818.3  
GGAAGTGGCTATCGCCAGAGTCGGATTCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCG
HKR373281 RBd33D09 pGCAP10 NM_022818.3  
GGCCAGAGTCGGATTCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGGACCCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl