Prev. |  KEGG KO K05745 > 

RIKEN DNA Bank Human Resource - DIAPH3

Gene ID NCBI Gene 81624 |  KEGG hsa:81624
Gene Symbol DIAPH3
Protein Name diaphanous related formin 3
Synonyms AN|AUNA1|DIA2|DRF3|NSDAN|diap3|mDia2
Ortholog resource in our bank

  DIAPH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013840 IRAK034J24 pBluescriptR BC034952 NM_030932 Full/var
HGY042612 IRAK106I20 pBluescript BC048963 NM_030932 Full
HGY067000 IRAK167I08 pBluescriptR BC068504 NM_030932 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062836 ARe57B12 pKA1U5 NM_030932.3  
GCCCAGNTGGCCCCGAGGAGCCTGGGGAGAAGCGCCCCAAGTTTCATTTAAATATTAGGA
HKR184829 ARi62B05 pGCAP10 NM_030932.3  
GNTTGGGCTAGGCTGTGCTGACTGTTGGNNGGNGGACCNGGGAGTNNCNGTTGTCNATCC
HKR186171 ARi65H03 pGCAP10 NM_030932.3  
GGGGCTAGGCTGTGCTGACTGTTTGGGTGGCGGACCCCGGGAGTAAAACCTGTTGTCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl