Prev. |  KEGG KO K18265 > 

RIKEN DNA Bank Human Resource - ITM2C

Gene ID NCBI Gene 81618 |  KEGG hsa:81618
Gene Symbol ITM2C
Protein Name integral membrane protein 2C
Synonyms BRI3|BRICD2C|E25|E25C|ITM3
Ortholog resource in our bank

  ITM2C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019898 IRAK049M10 pCMV-SPORT6 BC025742 NM_001012516 Full/var
HGX044154 IRAK110G10 pCMV-SPORT6 BC050668 NM_001012514 Full
HGY082339 IRAL005O03 pOTB7 BC002424 NM_030926 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE026934 W01A067F14 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033722 W01A084F02 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033724 W01A084F04 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033728 W01A084F08 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033730 W01A084F10 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033736 W01A084F16 pENTR-TOPO flj0003g07 AK056321 NM_001012514  
HGE033738 W01A084F18 pENTR-TOPO flj0003g07 AK056321 NM_001012514  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR341229 RBb53B05 pGCAP1 NM_030926.4  
GCCGGTGCCTGCAGAGCTCGGAGCGGCGGAGGCAGAGACCGAGGCTGCACCGGCAGAGGC
HKR394409 RBd86A09 pGCAP10 NM_030926.4  
GGCAGAGCTCGGAGCGGCGGAGGCTGAGACCGAGGCTGCACCGGCAGAGGCTGCGGGGCG
HKR406182 RBdS015H14 pGCAP10 NM_030926.4  
GGGAGCGGCGGAGGCAGAGACCGAGGCTGCACCGGCAGAGGCTGCGGGGCGGACGCGCGG
HKR470934 RBdS177F14 pGCAP10 NM_030926.4  
GGGAGCGGCGGAGGCAGAGACCGAGGCTGCACCGGCAGAGGCTGCGGGGCGGACGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl