Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANP32E

Gene ID (NCBI) 81611
Gene Symbol ANP32E
Protein Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Synonyms LANP-L|LANPL
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001429 IRAK003J13 pCMV-SPORT6 BC003380 NM_030920 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE037226 W01A093B02 pENTR-TOPO flj0003l03 AK092672 NM_030920
HGE037274 W01A093D02 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037292 W01A093D20 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037296 W01A093D24 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037322 W01A093F02 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037326 W01A093F06 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037330 W01A093F10 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE037567 W01A093P07 pENTR-TOPO flj0003l03 AK092672 NM_030920
HGE037583 W01A093P23 pENTR-TOPO flj0003l03 AK092672 NM_030920
HGE045722 W01A114F02 pENTR-TOPO flj0003l03 AK092672 NM_030920
HGE045736 W01A114F16 pENTR-TOPO IRAK003J13 BC003380 NM_030920
HGE045738 W01A114F18 pENTR-TOPO IRAK003J13 BC003380 NM_030920

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR184078 ARi60D06 pGCAP10 NM_030920.2
GCTTTCTTTCTCCCCCACACCTATCTGGTGGTGGTAGTGGGCGTTTATATTTGCGTTCCT
HKR209258 ARiS023C10 pGCAP10 NM_030920.2
GAGTCTCTGAGCAGCCATTGAAGGGGAAGGAACTGCGGGTGTGTGTGTGTATGTGTGTGT
HKR370079 RBd25D07 pGCAP10 NM_030920.2
GAGTCTCTGAGCAGCCATTGAAGGGGAAGGAACTGCGGGTGTGTGTGTGTATGTGTGTGT
HKR396098 RBd90E02 pGCAP10 NM_030920.2
GAGTCTCTGAGCAGCCATTGAAGGGGAAGGAACTGCGGGTGTGTGTGTGTATGTGTGTGT
HKR403148 RBdS007O12 pGCAP10 NM_030920.2
GAGTCTCTGAGCAGCCATTGAAGGGGAAGGAACTGCGGGTGTGTGTGTGTATGTGTGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl