Prev. |  KEGG KO K14405 > 

RIKEN DNA Bank Human Resource - FIP1L1

Gene ID NCBI Gene 81608 |  KEGG hsa:81608
Gene Symbol FIP1L1
Protein Name factor interacting with PAPOLA and CPSF1
Synonyms FIP1|Rhe|hFip1
Ortholog resource in our bank

  FIP1L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15460 pFLAG-FIP1L1-PDGFRA-FL Expression vector of human FIP1L1-PDGFRA (full-length), FLAG-tag.
RDB15461 pFLAG-FIP1L1-PDGFRA-KD Expression vector of human FIP1L1-PDGFRA (kinase-dead mutant), FLAG-tag.
RDB15463 pCGT-FIP1L1-PDGFRA-FL Expression vector of human FIP1L1-PDGFRA (full-length), T7-tag.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005584 IRAK013P24 pCMV-SPORT6 BC011543 NM_030917 Partial
HGX008023 IRAK020A23 pCMV-SPORT6 BC017724 NM_030917 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR377603 RBd44A03 pGCAP10 NM_030917.3  
GGCTGGAGGCTTCATCTTTGCCGCCGCTGCCGTCGCCTTCCTGGGATTGGAGTCTCGAGC
HKR380433 RBd51B09 pGCAP10 NM_030917.3  
GGCTGGAGGCTTCATCTTTGCCGCCGCTGCCGTCGCCTTCCTGGGATTGGAGTCTCGAGC
HKR432629 RBdS081J13 pGCAP10 NM_030917.3  
GGCCCTTCTCGCGCCTCGGGGCTGCGAGGCTGGGGAAGGGGTTGGAGGGGGCTGTTGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.01

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl