Prev. |  KEGG KO K12161 > 

RIKEN DNA Bank Human Resource - URM1

Gene ID NCBI Gene 81605 |  KEGG hsa:81605
Gene Symbol URM1
Protein Name ubiquitin related modifier 1
Synonyms C9orf74
Ortholog resource in our bank

  URM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083336 IRAL008F16 pOTB7 BC003581 NM_030914
HGY086132 IRAL015F12 pOTB7 BC011620 NM_030914 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068807 ARe72A07 pKA1U5 NM_030914.2  
GCTCAACATGGCTGCGCCCTTGTCAGTGGAGGTGGAGTTCGGAGGTGGTGCGGAGCTCCT
HKR430256 RBdS075K16 pGCAP10 NM_030914.2  
GGAGCTCGNCTTCCTCAACATGGCTGCGCCCTTGTCAGTGGAGGTGGAGTTCGGAGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl