Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANKRD13C

Gene ID (NCBI) 81573
Gene Symbol ANKRD13C
Protein Name ankyrin repeat domain 13C
Synonyms RP4-677H15.5|dJ677H15.3
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY096877 IRAL042D05 pOTB7 BC028840 NM_030816 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE100831 M01C052B07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE100879 M01C052D07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE100927 M01C052F07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE100975 M01C052H07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE101023 M01C052J07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE101071 M01C052L07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE101119 M01C052N07 pDONR221 MGC15-G04 BC028840 ENST00000370944
HGE101167 M01C052P07 pDONR221 MGC15-G04 BC028840 ENST00000370944

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041210 ARe03A10 pKA1U5 NM_030816.4
GGCGGTGTTTTCTCTCTCTTCACTCCTGGGGGAGCTCTCGCGAGAGGAGCAAGAGGAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl