Prev. |  KEGG KO K21437 > 

RIKEN DNA Bank Human Resource - ANKRD13C

Gene ID NCBI Gene 81573 |  KEGG hsa:81573
Gene Symbol ANKRD13C
Protein Name ankyrin repeat domain 13C
Synonyms dJ677H15.3
Ortholog resource in our bank

  ANKRD13C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096877 IRAL042D05 pOTB7 BC028840 NM_030816 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100831 M01C052B07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE100879 M01C052D07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE100927 M01C052F07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE100975 M01C052H07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE101023 M01C052J07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE101071 M01C052L07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE101119 M01C052N07 pDONR221 MGC15-G04 BC028840 ENST00000370944  
HGE101167 M01C052P07 pDONR221 MGC15-G04 BC028840 ENST00000370944  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041210 ARe03A10 pKA1U5 NM_030816.4  
GGCGGTGTTTTCTCTCTCTTCACTCCTGGGGGAGCTCTCGCGAGAGGAGCAAGAGGAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl