Prev. |  KEGG KO K13984 > 

RIKEN DNA Bank Human Resource - TXNDC5

Gene ID NCBI Gene 81567 |  KEGG hsa:81567
Gene Symbol TXNDC5
Protein Name thioredoxin domain containing 5
Synonyms ENDOPDI|ERP46|HCC-2|HCC2|PDIA15|STRF8|UNQ364
Ortholog resource in our bank

  TXNDC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082500 IRAL006E04 pOTB7 BC001199 NM_030810 Partial
HGY085453 IRAL013K13 pOTB7 BC003529
HGY099168 IRAL047P08 pOTB7 BC052310 NM_022085 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023533 W01A058N21 pENTR-TOPO IRAL047P08 BC052310 NM_022085  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052075 ARe30D03 pKA1U5 NM_022085.3  
GGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCTGGCCCGGCCGGCG
HKR059233 ARe48B09 pKA1U5 NM_022085.3  
TGAGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCTGGCCCGGCCGG
HKR070456 ARe76C08 pKA1U5 NM_022085.3  
GCCGCGAATGCCCGCACGCCCANGACTCCTCCTCCCNTNTGNTGGCCCGGCCGGCNGCCC
HKR162146 ARi05G02 pGCAP10 NM_022085.3  
GAGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCTGGCCCGGCCGGC
HKR169602 ARi24A02 pGCAP10 NM_022085.3  
GACCGGAGGCCGCGGCGAGAGCGCGCCCAGCCCCGCCGCGANNNNTTNNGCGCCCAGGAC
HKR323325 RBb08F05 pKA1U5 NM_022085.3  
GGCGGCGAGAGCGCGCCCAGCCCCGCCGCGATGCCNGCGCGCCCAGGACGCCTCCTCCCG
HKR342908 RBb57E12 pGCAP1 NM_022085.3  
GCGAGGGGACCGGANGCCGCNGCGAGAGCGCNCCCAGCCCCGCCNCGATGCCCGCGCGCC
HKR387753 RBd69G09 pGCAP10 NM_022085.3  
GAGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCTGGCCCGGCCGGC
HKR390979 RBd77H11 pGCAP10 NM_022085.3  
GAGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCTGGCCCGGCCGGC
HKR444152 RBdS110G08 pGCAP10 NM_022085.3  
GGAGAGCGCGCCCNGCCCCGCCGCGATGCCCGCGCGCCCAGGACGCCTCCTCCCGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl