Prev. |  KEGG KO K09595 > 

RIKEN DNA Bank Human Resource - HM13

Gene ID NCBI Gene 81502 |  KEGG hsa:81502
Gene Symbol HM13
Protein Name histocompatibility minor 13
Synonyms H13|IMP1|IMPAS|IMPAS-1|MSTP086|PSENL3|PSL3|SPP|SPPL1
Ortholog resources KEGG ortholog (KEGG orthology K09595) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054301 IRAK135M13 pCMV-SPORT6 BC062595 NM_030789 Full
HGY081020 IRAL002J04 pOTB7 BC008938 NM_030789 Full/var
HGY084023 IRAL010A23 pOTB7 BC008959 NM_030789 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE026449 W01A066C01 pENTR-TOPO flj0017b22 AK074686 NM_178582  
HGE026453 W01A066C05 pENTR-TOPO flj0017b22 AK074686 NM_178582  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172174 ARi30H06 pGCAP10 NM_030789.2  
GGTGGCTTTCCCTGCAGAGCCGGTGTCTCCGCCTGCGTCCCTGCTGCAGCAACCGGAGCT
HKR209583 ARiS023P23 pGCAP10 NM_030789.2  
GGCCTTAGGGGAACGTGGCTTTCCCTGCAGAGCCGGTGTCTCCGCCTGCGTCCCTGCTGC
HKR452958 RBdS132G14 pGCAP10 NM_030789.2  
GGCGCCCGCGCCGGCCTTCCTGCAGGGGACTCCACCGGAGCCTTGCCAATTCCGTTTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl