Prev. |  KEGG KO K04321 > 

RIKEN DNA Bank Human Resource - GPR63

Gene ID NCBI Gene 81491 |  KEGG hsa:81491
Gene Symbol GPR63
Protein Name G protein-coupled receptor 63
Synonyms PSP24(beta)|PSP24B
Ortholog resource in our bank

  GPR63

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY068810 IRAK172A10 pDNR-Dual BC067465 NM_030784 Full
HGY068811 IRAK172A11 pDNR-Dual BC067466 NM_030784 Full/var
HGY068812 IRAK172A12 pDNR-Dual BC067467 NM_030784 Full/var
HGY068813 IRAK172A13 pDNR-Dual BC067468 NM_030784 Full/var
HGY068814 IRAK172A14 pDNR-Dual BC067469 NM_030784 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR432493 RBdS081D21 pGCAP10 NM_030784.2  
GNAGTGCTATGTCAGGAAAGTTCCGGGAGGGACTACATGGAGCCATGCTCCCTGGGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl