Prev. |  KEGG KO K08730 > 

RIKEN DNA Bank Human Resource - PTDSS2

Gene ID NCBI Gene 81490 |  KEGG hsa:81490
Gene Symbol PTDSS2
Protein Name phosphatidylserine synthase 2
Synonyms PSS2
Ortholog resource in our bank

  PTDSS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082776 IRAL006P16 pOTB7 BC001210 NM_030783

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097222 M01C043A22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097270 M01C043C22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097318 M01C043E22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097366 M01C043G22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097414 M01C043I22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097462 M01C043K22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097510 M01C043M22 pDONR221 MGC11-B11 BC001210 NM_030783  
HGE097558 M01C043O22 pDONR221 MGC11-B11 BC001210 NM_030783  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167751 ARi19G07 pGCAP10 NM_030783.1  
GCGTGGGGTCGAGGCGCCGGGCGGAGTGGCTCCGGGCCGAAACGCCATGCGGAGGGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl