Prev. | 

RIKEN DNA Bank Human Resource - CLPTM1L

Gene ID NCBI Gene 81037 |  KEGG hsa:81037
Gene Symbol CLPTM1L
Protein Name CLPTM1 like
Synonyms CRR9
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008619 IRAK021J03 pCMV-SPORT6 BC016399 NM_030782 Partial/var
HGX035727 IRAK089F07 pCMV-SPORT6 BC040705 NM_030782 Partial
HGY096805 IRAL042A05 pOTB7 BC025305 NM_030782 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081212 ARf03A12 pKA1U5 NM_030782.3  
GGGGGCCGGAGCATGCGGGGCGGCCGGCGGTCTGCGGCGCGCGGCGCATTCGTTCCCCCG
HKR371369 RBd28H01 pGCAP10 NM_030782.3  
GGGCGCGCGGGGCCGGCGAATCCCGCGGCGCCAGGTGGGAGCGGGGCCGGAGCATGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl