Prev. |  KEGG KO K15115 > 

RIKEN DNA Bank Human Resource - SLC25A32

Gene ID NCBI Gene 81034 |  KEGG hsa:81034
Gene Symbol SLC25A32
Protein Name solute carrier family 25 member 32
Synonyms MFT|MFTC|RREI
Ortholog resource in our bank

  SLC25A32

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019700 W01A049E04 pENTR-TOPO flj0033c23 AK027531 NM_030780  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248943 ARiS122F23 pGCAP10 NM_030780.3  
GTCCTCTCGTTGGTCCCGGAGGTGGGGTTGCGCTCACAAGGGGCGACCGTCGCCACGGTG
HKR441830 RBdS104J14 pGCAP10 NM_030780.3  
GGGGGTTGCGCTCACAAGGGGCGACCGTCGCCACGGTGGCGGCCACTGCATCGCGTCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl