Prev. |  KEGG KO K09636 > 

RIKEN DNA Bank Human Resource - TMPRSS5

Gene ID NCBI Gene 80975 |  KEGG hsa:80975
Gene Symbol TMPRSS5
Protein Name transmembrane serine protease 5
Synonyms SPINESIN
Ortholog resource in our bank

  TMPRSS5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180432 ARi51B08 pGCAP10 NM_030770.2  
GATAGTGGTCTGGTGCTCTCCATCAGGAAGAACTAACTGGCTGTTTCTCTGTGTCTCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl