Prev. |  KEGG KO K01639 > 

RIKEN DNA Bank Human Resource - NPL

Gene ID NCBI Gene 80896 |  KEGG hsa:80896
Gene Symbol NPL
Protein Name N-acetylneuraminate pyruvate lyase
Synonyms C112|C1orf13|NAL|NPL1
Ortholog resource in our bank

  NPL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099284 IRAL048D12 pDNR-LIB BC058003

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392034 RBd80B10 pGCAP10 NM_030769.1  
GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGAAGGGGAAACTGAAGCAGAAAGAGGT
HKR428080 RBdS070D08 pGCAP10 NM_030769.1  
GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGGTGAGCGCGGCCCGCGACGGCACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl