Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPL

Gene ID (NCBI) 80896
Gene Symbol NPL
Protein Name N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Synonyms C112|C1orf13|NAL|NPL1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY099284 IRAL048D12 pDNR-LIB BC058003

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR392034 RBd80B10 pGCAP10 NM_030769.1
GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGAAGGGGAAACTGAAGCAGAAAGAGGT
HKR428080 RBdS070D08 pGCAP10 NM_030769.1
GGGAGCGGCTGCACGGACAAGAGCGGAGGCCTGGGTGAGCGCGGCCCGCGACGGCACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl