Prev. |  KEGG KO K17500 > 

RIKEN DNA Bank Human Resource - ILKAP

Gene ID NCBI Gene 80895 |  KEGG hsa:80895
Gene Symbol ILKAP
Protein Name ILK associated serine/threonine phosphatase
Synonyms ILKAP2|ILKAP3|PP2C-DELTA|PPM1O
Ortholog resource in our bank

  ILKAP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031892 IRAK079M04 pCMV-SPORT6 BC035746 NM_176799 Full
HGY084588 IRAL011H20 pOTB7 BC006576 NM_030768 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006562 W01A016G18 pENTR-TOPO IRAL011H20 BC006576 NM_030768  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168180 ARi20H12 pGCAP10 NM_030768.2  
GCCCGTCGCCCGCCCGCTGCTGCCGCCCGCCCGGGGTGTGGAGCCCGGCCGCTGCTCGCG
HKR248904 ARiS122E08 pGCAP10 NM_030768.2  
AAGCTGCTGCCGCCCGCCCGGGGTGTGGAGCCCGGCCGCTGCTCGCGGGCTGAGTGTCTG
HKR444361 RBdS110P01 pGCAP10 NM_030768.2  
GACTCTCCCTGCAGGTGACTGACGGCGCCGGCCGCCCCTGCCCGTCGCCCGCCCGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl