Prev. |  KEGG KO K11431 > 

RIKEN DNA Bank Human Resource - SETD7

Gene ID NCBI Gene 80854 |  KEGG hsa:80854
Gene Symbol SETD7
Protein Name SET domain containing 7, histone lysine methyltransferase
Synonyms KMT7|SET7|SET7/9|SET9
Ortholog resource in our bank

  SETD7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067385 IRAK168H17 pBluescriptR BC066361 NM_030648 Partial/var
HGY090211 IRAL025I19 pOTB7 BC012784 NM_030648

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048922 ARe22F02 pKA1U5 NM_030648.2  
GCTCTTCCTCCTCCTCCTCCAAACTCGCGAGCCCCAGAGCTCGCTCAGCCGCCGGGAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl