Prev. | 

RIKEN DNA Bank Human Resource - ZFP91

Gene ID NCBI Gene 80829 |  KEGG hsa:80829
Gene Symbol ZFP91
Protein Name ZFP91 zinc finger protein, atypical E3 ubiquitin ligase
Synonyms DMS-8|DSM-8|DSM8|FKSG11|PZF|ZFP-91|ZNF757
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03970 pWEAxCAhCNTF-F/RGD Shuttle vector to generate rAd expressing human CNTF
RDB03971 AxCAhCNTF-F/RGD Recombinant adenovirus expressing human CNTF cDNA
RDB03980 pCAhCNTF Expression vector of human CNTF cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036178 IRAK090H10 pBluescript BC051743 NM_053023 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE039102 W01A097M14 pENTR-TOPO IRAK090H10 BC051743 NM_053023  
HGE039104 W01A097M16 pENTR-TOPO IRAK090H10 BC051743 NM_053023  
HGE039110 W01A097M22 pENTR-TOPO IRAK090H10 BC051743 NM_053023  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR408918 RBdS022E22 pGCAP10 NM_053023.3  
GAGAGTGAGCCGCAGGCTTCGGGAGGCGAGGGGGCGGGGGGAGCAGCGCCGAGGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl